Stem-loop sequence mmu-mir-6950

AccessionMI0022797 (change log)
Symbol MGI:Mir6950
DescriptionMus musculus miR-6950 stem-loop
Stem-loop
   cucugu       u   ---      uc    ag  ag 
5'       ccuggag gga   ggacag  agaa  gc  u
         ||||||| |||   ||||||  ||||  ||  u
3'       ggaccuc ccu   ucuguc  ucuu  cg  g
   acuguu       u   agu      --    -a  au 
Get sequence
Deep sequencing
134 reads, 9.09 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 69692248-69692320 [+]
sense
OTTMUST00000117113 ; Loxl2-001; 3'UTR (exon 13)
OTTMUST00000117114 ; Loxl2-002; 3'UTR (exon 13)
ENSMUST00000022660 ; Loxl2-001; 3'UTR (exon 13)
ENSMUST00000100420 ; Loxl2-002; 3'UTR (exon 13)
Database links

Mature sequence mmu-miR-6950-5p

Accession MIMAT0027800
Sequence

6 - 

uccuggaguggaggacagucaga

 - 28

Get sequence
Deep sequencing99 reads, 26 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6950-3p

Accession MIMAT0027801
Sequence

46 - 

cucugucuugauccucuccag

 - 66

Get sequence
Deep sequencing27 reads, 12 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).