Stem-loop sequence mmu-mir-6942

AccessionMI0022789 (change log)
Symbol MGI:Mir6942
DescriptionMus musculus miR-6942 stem-loop
Stem-loop
   --   ccu   a        a   uu  a  u 
5'   ggg   agg ggagggga cau  gc ac a
     |||   ||| |||||||| |||  || ||  
3'   cuc   ucc ccucucuu gua  cg ug u
   ga   ---   a        g   uu  g  a 
Get sequence
Deep sequencing
225 reads, 0 reads per million, 49 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 21396578-21396638 [-]
sense
OTTMUST00000000992 ; Zkscan3-001; intron 1
OTTMUST00000000993 ; Zkscan3-002; intron 1
OTTMUST00000078179 ; Zkscan3-003; intron 1
OTTMUST00000078180 ; Zkscan3-004; intron 1
ENSMUST00000116434 ; Zkscan3-001; intron 1
ENSMUST00000070785 ; Zkscan3-003; intron 1
ENSMUST00000117721 ; Zkscan3-004; intron 1
ENSMUST00000116433 ; Zkscan3-002; intron 1
Database links

Mature sequence mmu-miR-6942-5p

Accession MIMAT0027784
Sequence

6 - 

uaggaggaggggaacauuugc

 - 26

Get sequence
Deep sequencing223 reads, 47 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6942-3p

Accession MIMAT0027785
Sequence

39 - 

uuaugguucucuccaccucuca

 - 60

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).