Stem-loop sequence mmu-mir-6939

AccessionMI0022786 (change log)
Symbol MGI:Mir6939
DescriptionMus musculus miR-6939 stem-loop
Literature search

1 open access papers mention mmu-mir-6939
(1 sentences)

Stem-loop
   gagccag     u   ug ug  a   aug  aca     c 
5'        gcagc ggu  g  ga gcc   ca   gcgcc c
          ||||| |||  |  || |||   ||   |||||  
3'        cgucg cca  u  cu cgg   gu   cgugg c
   -----ga     c   gu ca  c   --a  --c     a 
Get sequence
Deep sequencing
42 reads, 0 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 112659277-112659351 [-]
sense
OTTMUST00000049503 ; Akt1-008; intron 1
OTTMUST00000049500 ; Akt1-006; intron 3
OTTMUST00000049498 ; Akt1-004; intron 3
OTTMUST00000049495 ; Akt1-001; intron 4
OTTMUST00000049496 ; Akt1-002; intron 4
OTTMUST00000049497 ; Akt1-003; intron 4
ENSMUST00000123563 ; Akt1-008; intron 1
ENSMUST00000128300 ; Akt1-006; intron 3
ENSMUST00000139388 ; Akt1-004; intron 3
ENSMUST00000001780 ; Akt1-001; intron 4
ENSMUST00000144550 ; Akt1-002; intron 4
ENSMUST00000130342 ; Akt1-003; intron 4
Database links

Mature sequence mmu-miR-6939-5p

Accession MIMAT0027778
Sequence

5 - 

caggcagcugguugguggaag

 - 25

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6939-3p

Accession MIMAT0027779
Sequence

56 - 

ccucacuugacccgcugcag

 - 75

Get sequence
Deep sequencing37 reads, 27 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).