Stem-loop sequence mmu-mir-6938

AccessionMI0022785 (change log)
Symbol MGI:Mir6938
DescriptionMus musculus miR-6938 stem-loop
Stem-loop
   aguguuu    c          --ga    gaa 
5'        ggag uagcuccaga    gagu   g
          |||| ||||||||||    ||||    
3'        ccuc gucggggucu    uucg   u
   ---gauu    u          acug    uac 
Get sequence
Deep sequencing
23 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 85245923-85245985 [-]
sense
ENSMUST00000166821 ; Mlh3-202; intron 7
ENSMUST00000019378 ; Mlh3-201; intron 7
Database links

Mature sequence mmu-miR-6938-5p

Accession MIMAT0027776
Sequence

6 - 

uuggagcuagcuccagagagagu

 - 28

Get sequence
Deep sequencing6 reads, 5 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6938-3p

Accession MIMAT0027777
Sequence

42 - 

ucaucuggggcugucuccuuag

 - 63

Get sequence
Deep sequencing14 reads, 10 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).