Stem-loop sequence mmu-mir-6937

AccessionMI0022784 (change log)
Symbol MGI:Mir6937
DescriptionMus musculus miR-6937 stem-loop
Literature search

2 open access papers mention mmu-mir-6937
(6 sentences)

Stem-loop
   -   c        cu gg      ugaucgguc 
5'  uag uguaaggg  g  ucugug         u
    ||| ||||||||  |  ||||||          
3'  auc acguuccc  c  ggacac         c
   g   -        -c uu      ucaaaggac 
Get sequence
Deep sequencing
4867 reads, 9.23 reads per million, 65 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 28679325-28679389 [+]
sense
OTTMUST00000055373 ; Adi1-003; intron 1
OTTMUST00000055371 ; Adi1-001; intron 2
OTTMUST00000055372 ; Adi1-002; intron 2
ENSMUST00000138081 ; Adi1-003; intron 1
ENSMUST00000020957 ; Adi1-001; intron 2
ENSMUST00000135772 ; Adi1-002; intron 2
Database links

Mature sequence mmu-miR-6937-5p

Accession MIMAT0027774
Sequence

1 - 

uagcuguaagggcugggucugugu

 - 24

Get sequence
Deep sequencing4853 reads, 64 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6937-3p

Accession MIMAT0027775
Sequence

43 - 

ucacagguucccccuugcacuag

 - 65

Get sequence
Deep sequencing13 reads, 9 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).