Stem-loop sequence mmu-mir-6927

AccessionMI0022774 (change log)
Symbol MGI:Mir6927
DescriptionMus musculus miR-6927 stem-loop
Stem-loop
   ------  g      u     c       g   ga  a 
5'       gu agggga ccagc caggcua ggg  ag a
         || |||||| ||||| ||||||| |||  || u
3'       cg uccccu ggucg guccggu ccc  uc c
   ccucga  -      c     a       g   -g  c 
Get sequence
Deep sequencing
69 reads, 117 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 97677060-97677130 [+]
sense
OTTMUST00000005446 ; Mllt6-003; intron 3
OTTMUST00000014169 ; Mllt6-006; intron 3
OTTMUST00000005444 ; Mllt6-001; intron 15
OTTMUST00000014167 ; Mllt6-004; intron 15
OTTMUST00000005445 ; Mllt6-002; intron 16
ENSMUST00000151729 ; Mllt6-003; intron 3
ENSMUST00000143220 ; Mllt6-006; intron 3
ENSMUST00000044730 ; Mllt6-001; intron 15
ENSMUST00000107586 ; Mllt6-004; intron 15
ENSMUST00000155835 ; Mllt6-002; intron 16
Database links

Mature sequence mmu-miR-6927-5p

Accession MIMAT0027754
Sequence

1 - 

gugaggggauccagcccaggcu

 - 22

Get sequence
Deep sequencing20 reads, 12 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6927-3p

Accession MIMAT0027755
Sequence

47 - 

ccugagcuggcuccccugcag

 - 67

Get sequence
Deep sequencing48 reads, 24 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).