Stem-loop sequence mmu-mir-6926

AccessionMI0022773 (change log)
Symbol MGI:Mir6926
DescriptionMus musculus miR-6926 stem-loop
Stem-loop
   ucggguca      ug           ugaaag   c 
5'         gugggg  agggaugguga      agc c
           ||||||  |||||||||||      |||  
3'         uaccuc  ucccuaccacu      ucg c
   ------ga      ug           --uaaa   a 
Get sequence
Deep sequencing
66 reads, 0 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 74868127-74868194 [-]
sense
OTTMUST00000013943 ; Sgsm2-005; intron 1
OTTMUST00000013942 ; Sgsm2-004; intron 3
OTTMUST00000013939 ; Sgsm2-001; intron 5
OTTMUST00000013940 ; Sgsm2-002; intron 5
ENSMUST00000148421 ; Sgsm2-005; intron 1
ENSMUST00000156287 ; Sgsm2-004; intron 3
ENSMUST00000057631 ; Sgsm2-001; intron 5
ENSMUST00000081799 ; Sgsm2-002; intron 5
Database links

Mature sequence mmu-miR-6926-5p

Accession MIMAT0027752
Sequence

6 - 

ucaguggggugagggaugguga

 - 27

Get sequence
Deep sequencing63 reads, 27 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6926-3p

Accession MIMAT0027753
Sequence

48 - 

ucaccaucccugucuccauag

 - 68

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).