Stem-loop sequence mmu-mir-6925

AccessionMI0022772 (change log)
Symbol MGI:Mir6925
DescriptionMus musculus miR-6925 stem-loop
Stem-loop
   ----aa  c     aag      cuu    u -ac  a 
5'       gc ugagg   agaagg   ggac g   uc u
         || |||||   ||||||   |||| |   || c
3'       cg acucc   uuuucc   ccug c   ag c
   aacuaa  -     cua      ---    c auu  u 
Get sequence
Deep sequencing
202 reads, 0 reads per million, 46 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 70705990-70706059 [+]
sense
OTTMUST00000090748 ; Kif1c-004; 3'UTR (exon 10)
OTTMUST00000013709 ; Kif1c-003; 3'UTR (exon 11)
OTTMUST00000013707 ; Kif1c-001; 3'UTR (exon 11)
OTTMUST00000013708 ; Kif1c-002; 3'UTR (exon 11)
OTTMUST00000090749 ; Kif1c-005; 3'UTR (exon 11)
ENSMUST00000072187 ; Kif1c-004; 3'UTR (exon 10)
ENSMUST00000152618 ; Kif1c-003; 3'UTR (exon 11)
ENSMUST00000102554 ; Kif1c-001; 3'UTR (exon 11)
ENSMUST00000094499 ; Kif1c-002; 3'UTR (exon 11)
ENSMUST00000137119 ; Kif1c-005; 3'UTR (exon 11)
Database links

Mature sequence mmu-miR-6925-5p

Accession MIMAT0027750
Sequence

6 - 

ugaggaagagaaggcuuggacu

 - 27

Get sequence
Deep sequencing193 reads, 44 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6925-3p

Accession MIMAT0027751
Sequence

46 - 

uccccuuuuaucccucag

 - 63

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).