Stem-loop sequence mmu-mir-6922

AccessionMI0022769 (change log)
Symbol MGI:Mir6922
DescriptionMus musculus miR-6922 stem-loop
Literature search

1 open access papers mention mmu-mir-6922
(1 sentences)

Stem-loop
   auugg           acu      a     gug 
5'      ugugggagggg   guagag ggagg   c
        |||||||||||   |||||| |||||    
3'      acacucuuccc   cgucuu ucucc   c
   ----g           acu      g     aau 
Get sequence
Deep sequencing
193 reads, 0 reads per million, 37 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 60202262-60202327 [-]
sense
OTTMUST00000012869 ; Srebf1-004; exon 1
OTTMUST00000012867 ; Srebf1-002; intron 3
OTTMUST00000012871 ; Srebf1-006; intron 11
OTTMUST00000012870 ; Srebf1-005; intron 12
OTTMUST00000012872 ; Srebf1-007; intron 12
ENSMUST00000156304 ; Srebf1-004; exon 1
ENSMUST00000154925 ; Srebf1-002; intron 3
ENSMUST00000134660 ; Srebf1-006; intron 11
ENSMUST00000020846 ; Srebf1-005; intron 12
ENSMUST00000144942 ; Srebf1-007; intron 12
Clustered miRNAs
< 10kb from mmu-mir-6922
mmu-mir-6922chr11: 60202262-60202327 [-]
mmu-mir-6921chr11: 60200538-60200617 [-]
Database links

Mature sequence mmu-miR-6922-5p

Accession MIMAT0027744
Sequence

6 - 

ugugggaggggacuguagagagg

 - 28

Get sequence
Deep sequencing153 reads, 34 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6922-3p

Accession MIMAT0027745
Sequence

44 - 

uguucugcucacccuucucacag

 - 66

Get sequence
Deep sequencing39 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).