Stem-loop sequence mmu-mir-6917

AccessionMI0022764 (change log)
Symbol MGI:Mir6917
DescriptionMus musculus miR-6917 stem-loop
Stem-loop
   -gaa    u           u ugcc    u u 
5'     ggug ggaaggggagu g    gcag c u
       |||| ||||||||||| |    |||| |  
3'     ccac ccuucucuuca c    uguc g c
   gaca    -           - ----    c a 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 128584437-128584497 [-]
sense
OTTMUST00000074150 ; Erbb3-001; intron 3
ENSMUST00000082059 ; Erbb3-001; intron 3
Database links

Mature sequence mmu-miR-6917-5p

Accession MIMAT0027734
Sequence

6 - 

uguggaaggggaguugugccg

 - 26

Get sequence
Deep sequencing7 reads, 7 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6917-3p

Accession MIMAT0027735
Sequence

40 - 

gucacuucucuucccaccacag

 - 61

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).