Stem-loop sequence mmu-mir-6916

AccessionMI0022763 (change log)
Symbol MGI:Mir6916
DescriptionMus musculus miR-6916 stem-loop
Stem-loop
   gcag c       u      g  u  - gggg 
5'     g aggagga ggagau ag ca c    u
       | ||||||| |||||| || || |     
3'     c uccuucu ccucug uu gu g    u
   --ga a       c      g  c  a auuc 
Get sequence
Deep sequencing
1927 reads, 18.9 reads per million, 53 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 128511968-128512030 [-]
sense
ENSMUST00000026427 ; Esyt1-201; intron 26
Database links

Mature sequence mmu-miR-6916-5p

Accession MIMAT0027732
Sequence

6 - 

caggaggauggagaugaguca

 - 26

Get sequence
Deep sequencing1919 reads, 54 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6916-3p

Accession MIMAT0027733
Sequence

42 - 

cuuggucucccucuuccuacag

 - 63

Get sequence
Deep sequencing7 reads, 6 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).