Stem-loop sequence mmu-mir-6914

AccessionMI0022761 (change log)
Symbol MGI:Mir6914
DescriptionMus musculus miR-6914 stem-loop
Stem-loop
      a u       u  u     cc     aacgag 
5' cug c ccugggg gg ggugg  acaga      g
   ||| | ||||||| || |||||  |||||      u
3' ggc g ggacccu uc ccacc  ugucu      c
      - c       -  u     --     caauuu 
Get sequence
Deep sequencing
186 reads, 0 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 128382838-128382906 [+]
sense
OTTMUST00000091848 ; Ankrd52-003; exon 11
OTTMUST00000091849 ; Ankrd52-001; 3'UTR (exon 11)
ENSMUST00000167990 ; Ankrd52-003; exon 11
ENSMUST00000014642 ; Ankrd52-001; 3'UTR (exon 11)
Clustered miRNAs
< 10kb from mmu-mir-6914
mmu-mir-6914chr10: 128382838-128382906 [+]
mmu-mir-6915chr10: 128388832-128388900 [+]
Database links

Mature sequence mmu-miR-6914-5p

Accession MIMAT0027728
Sequence

6 - 

uccugggguggugguggccacaga

 - 29

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6914-3p

Accession MIMAT0027729
Sequence

45 - 

ucuguccaccucuucccag

 - 63

Get sequence
Deep sequencing179 reads, 30 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).