Stem-loop sequence mmu-mir-6908

AccessionMI0022755 (change log)
Symbol MGI:Mir6908
DescriptionMus musculus miR-6908 stem-loop
Stem-loop
   gaagcu    u  -  -       ccc      g 
5'       ugcc gu ca gggagag   cagugu u
         |||| || || |||||||   ||||||  
3'       acgg cg gu cccucuc   gucgua g
   -----g    u  u  u       aca      g 
Get sequence
Deep sequencing
21 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 78445095-78445157 [-]
sense
OTTMUST00000048157 ; Pdxk-001; intron 7
OTTMUST00000048158 ; Pdxk-002; intron 7
ENSMUST00000041616 ; Pdxk-001; intron 7
ENSMUST00000105385 ; Pdxk-002; intron 7
Database links

Mature sequence mmu-miR-6908-5p

Accession MIMAT0027716
Sequence

6 - 

uugccugucagggagagcccca

 - 27

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6908-3p

Accession MIMAT0027717
Sequence

42 - 

acacucucccuugugcuggcag

 - 63

Get sequence
Deep sequencing15 reads, 14 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).