Stem-loop sequence mmu-mir-6907

AccessionMI0022754 (change log)
Symbol MGI:Mir6907
DescriptionMus musculus miR-6907 stem-loop
Literature search

1 open access papers mention mmu-mir-6907
(1 sentences)

Stem-loop
   gcuu            -     ucgauggguuggcug 
5'     cugggacacagg gaggc               u
       |||||||||||| |||||                
3'     gauccuguguuu cuuug               c
   ----            u     cgugcaaucauucuu 
Get sequence
Deep sequencing
25 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 78408475-78408545 [-]
sense
ENSMUST00000062678 ; Rrp1-201; intron 4
Database links

Mature sequence mmu-miR-6907-5p

Accession MIMAT0027714
Sequence

3 - 

uucugggacacagggaggcucg

 - 24

Get sequence
Deep sequencing17 reads, 14 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6907-3p

Accession MIMAT0027715
Sequence

47 - 

aacgugcguuucuuuuguguccu

 - 69

Get sequence
Deep sequencing7 reads, 7 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).