Stem-loop sequence mmu-mir-6899

AccessionMI0022746 (change log)
Symbol MGI:Mir6899
DescriptionMus musculus miR-6899 stem-loop
Stem-loop
   cag    c   a     -c     ---- g   u 
5'    gcag aga cgcag  gggca    u aga c
      |||| ||| |||||  |||||    | ||| c
3'    cguc ucu guguc  ccugu    a ucu u
   -ga    u   -     uu     uacc g   u 
Get sequence
Deep sequencing
46 reads, 0 reads per million, 30 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 64042438-64042501 [-]
sense
OTTMUST00000033149 ; Klf7-001; intron 2
ENSMUST00000114086 ; Klf7-001; intron 2
ENSMUST00000055001 ; Klf7-201; intron 2
Database links

Mature sequence mmu-miR-6899-5p

Accession MIMAT0027698
Sequence

6 - 

agcagaacgcagcgggcauga

 - 26

Get sequence
Deep sequencing16 reads, 14 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6899-3p

Accession MIMAT0027699
Sequence

42 - 

uuguccuucugugucuucugcag

 - 64

Get sequence
Deep sequencing30 reads, 20 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).