Stem-loop sequence mmu-mir-6897

AccessionMI0022744 (change log)
Symbol MGI:Mir6897
DescriptionMus musculus miR-6897 stem-loop
Stem-loop
          c  ugu    c     uuuau   g 
5' cuggggg ag   caca gcugu     gac u
   ||||||| ||   |||| |||||     |||  
3' gaccccc uc   gugu uggca     cug a
          u  -uu    c     ---cu   a 
Get sequence
Deep sequencing
35 reads, 0 reads per million, 22 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 36144252-36144313 [-]
sense
OTTMUST00000097355 ; Uggt1-004; intron 13
OTTMUST00000097356 ; Uggt1-002; intron 39
OTTMUST00000097354 ; Uggt1-001; intron 40
ENSMUST00000173999 ; Uggt1-004; intron 13
ENSMUST00000174266 ; Uggt1-002; intron 39
ENSMUST00000046875 ; Uggt1-001; intron 40
Database links

Mature sequence mmu-miR-6897-5p

Accession MIMAT0027694
Sequence

2 - 

ugggggcagugucacacgcuguu

 - 24

Get sequence
Deep sequencing33 reads, 22 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6897-3p

Accession MIMAT0027695
Sequence

42 - 

cggucuguguucuucccccag

 - 62

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).