Stem-loop sequence mmu-mir-6896

AccessionMI0022743 (change log)
Symbol MGI:Mir6896
DescriptionMus musculus miR-6896 stem-loop
Stem-loop
   uuucc        c  c    acccgugccuggugug 
5'      uuuguagg ga gaga                u
        |||||||| || ||||                 
3'      aaacaucc cu cucu                a
   --gac        a  -    cucuuugucacuaaua 
Get sequence
Deep sequencing
115 reads, 15.8 reads per million, 19 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 34117359-34117431 [+]
sense
OTTMUST00000116992 ; Dst-013; intron 3
OTTMUST00000116988 ; Dst-006; intron 4
OTTMUST00000116989 ; Dst-015; intron 4
OTTMUST00000116990 ; Dst-001; intron 4
OTTMUST00000116991 ; Dst-002; intron 4
OTTMUST00000116986 ; Dst-005; intron 5
OTTMUST00000116987 ; Dst-016; intron 5
OTTMUST00000116984 ; Dst-004; intron 7
OTTMUST00000116985 ; Dst-007; intron 7
ENSMUST00000182410 ; Dst-013; intron 3
ENSMUST00000183331 ; Dst-006; intron 4
ENSMUST00000182314 ; Dst-015; intron 4
ENSMUST00000097785 ; Dst-001; intron 4
ENSMUST00000097786 ; Dst-002; intron 4
ENSMUST00000115104 ; Dst-201; intron 4
ENSMUST00000182296 ; Dst-005; intron 5
ENSMUST00000182697 ; Dst-016; intron 5
ENSMUST00000182513 ; Dst-004; intron 7
ENSMUST00000183034 ; Dst-007; intron 7
Database links

Mature sequence mmu-miR-6896-5p

Accession MIMAT0027692
Sequence

6 - 

uuuguaggcgacgagaacccgu

 - 27

Get sequence
Deep sequencing106 reads, 16 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6896-3p

Accession MIMAT0027693
Sequence

50 - 

uuucucucucucaccuacaaac

 - 71

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).