![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-6745 |
|||||
Accession | MI0022590 (change log) | ||||
Symbol | HGNC:MIR6745 | ||||
Description | Homo sapiens miR-6745 stem-loop | ||||
Stem-loop |
gguccuugagggca ug gu ggga gauug - u agcccugggucuagcagccuau 5' ggagc g cuu cu cc ccuag ggcu g ||||| | ||| || || ||||| |||| g 3' ucuug c gaa ga gg ggguc cuga c ------------ac gu ug ---- ----a u - gguggucacaaauggucuguga |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-6745 |
|
Accession | MIMAT0027391 |
Sequence |
103 - uggguggaagaaggucugguu - 123 |
Deep sequencing | 32 reads, 22 experiments |
Evidence | experimental; meta-analysis [1] |
Predicted targets |
|
References |
|
1 |
PMID:22955976
"Discovery of hundreds of mirtrons in mouse and human small RNA data"
Genome Res. 22:1634-1645(2012).
|