Stem-loop sequence hsa-mir-892c

AccessionMI0022560 (change log)
Symbol HGNC:MIR892C
DescriptionHomo sapiens miR-892c stem-loop
Gene family MIPF0000386; mir-743
Literature search

3 open access papers mention hsa-mir-892c
(4 sentences)

Stem-loop
   --   ag   c             ugc    c  uuag 
5'   ggc  ugc cuauucagaaagg   cagu ac    a
     |||  ||| |||||||||||||   |||| ||    u
3'   ucg  aug ggugagucuuucc   guca ug    u
   au   gg   a             uuu    c  uaca 
Get sequence
Deep sequencing
104 reads, 2.17 reads per million, 46 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 145992750-145992826 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-892c
hsa-mir-891bchrX: 146001053-146001131 [-]
hsa-mir-892bchrX: 145997198-145997274 [-]
hsa-mir-892achrX: 145996669-145996743 [-]
hsa-mir-888chrX: 145994784-145994860 [-]
hsa-mir-890chrX: 145994275-145994351 [-]
hsa-mir-892cchrX: 145992750-145992826 [-]
Database links

Mature sequence hsa-miR-892c-5p

Accession MIMAT0025857
Sequence

11 - 

uauucagaaaggugccaguca

 - 31

Get sequence
Deep sequencing27 reads, 16 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-892c-3p

Accession MIMAT0025858
Sequence

46 - 

cacuguuuccuuucugagugga

 - 67

Get sequence
Deep sequencing25 reads, 15 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22313525 "Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis" Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY Gene. 497:330-335(2012).