Stem-loop sequence ghr-MIR399e

AccessionMI0022547 (change log)
DescriptionGossypium hirsutum miR399e stem-loop
Gene family MIPF0000015; MIR399
Literature search

12 open access papers mention ghr-MIR399e
(33 sentences)

Stem-loop
   aaaaa       g  c   a u   ug            a  gcaa    aac   guua            g a    a 
5'      ugcaugg ug auu c ggg  aaucuccuuugg ag    cuaa   ucg    cauugcauguug c ugcc u
        ||||||| || ||| | |||  |||||||||||| ||    ||||   |||    |||||||||||| | ||||  
3'      acguacc ac uaa g ccc  uuagaggaaacc uc    gauu   agc    guagcguacagc g gugg g
   gcaca       g  u   c c   gu            g  acuc    cgu   ----            g -    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ghr-miR399e

Accession MIMAT0025840
Sequence

117 - 

ugccaaaggagauuugccccg

 - 137

Get sequence
Evidence experimental; microarray [1]

References

1
PMID:22160515 "Difference in miRNA expression profiles between two cotton cultivars with distinct salt sensitivity" Yin Z, Li Y, Yu J, Liu Y, Li C, Han X, Shen F Mol Biol Rep. 39:4961-4970(2012).