Stem-loop sequence gga-mir-458b

AccessionMI0022541 (change log)
DescriptionGallus gallus miR-458b stem-loop
Gene family MIPF0000179; mir-458
Literature search

3 open access papers mention gga-mir-458b
(3 sentences)

Stem-loop
   --au     uuuuc   uacau       ua     caa          -  au 
5'     gcugu     cag     auggcag  ccauu   agagcuauga ca  g
       |||||     |||     |||||||  |||||   |||||||||| ||  a
3'     cggca     guc     uaccguc  gguaa   ucucgauauu gu  c
   gcgc     -ccac   -----       gc     aag          u  cg 
Get sequence
Deep sequencing
135 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr13: 8233317-8233418 [+]
antisense
ENSGALT00000035326 ; gga-mir-458a-201; exon 1
Clustered miRNAs
< 10kb from gga-mir-458b
gga-mir-458achr13: 8233311-8233426 [-]
gga-mir-458bchr13: 8233317-8233418 [+]
Database links

Mature sequence gga-miR-458b-5p

Accession MIMAT0025830
Sequence

26 - 

aguaccauucaaagagcuauga

 - 47

Get sequence
Deep sequencing34 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-458b-3p

Accession MIMAT0025831
Sequence

62 - 

auagcucugaaaauggcgcug

 - 82

Get sequence
Deep sequencing101 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).