Stem-loop sequence gga-mir-6516

AccessionMI0022520 (change log)
DescriptionGallus gallus miR-6516 stem-loop
Gene family MIPF0001672; mir-6516
Literature search

1 open access papers mention gga-mir-6516
(1 sentences)

Stem-loop
   agaggucccccugcuggguuccuccua       a  g ug   g    --c     
5'                            ugcagua ca g  uga cauc   augc 
                              ||||||| || |  ||| ||||   ||| a
3'                            acgucau gu u  acu guag   uacg 
   -aaccgacuucugucguugagcaacac       a  a gu   g    ucu     
Get sequence
Deep sequencing
131 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr18: 4170788-4170897 [-]
sense
ENSGALT00000042503 ; SCARNA16-201; exon 1
Database links

Mature sequence gga-miR-6516-5p

Accession MIMAT0025806
Sequence

27 - 

augcaguaacaggugugagcau

 - 48

Get sequence
Deep sequencing27 reads, 4 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence gga-miR-6516-3p

Accession MIMAT0025807
Sequence

69 - 

cauguaugauacugcacacaacg

 - 91

Get sequence
Deep sequencing102 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).