Stem-loop sequence gga-mir-1684b

AccessionMI0022501 (change log)
DescriptionGallus gallus miR-1684b stem-loop
Gene family MIPF0001537; mir-1684
Literature search

1 open access papers mention gga-mir-1684b
(1 sentences)

Stem-loop
   gcugccaaauggau     ---u  a       g    gc          a  cu   cu 
5'               cgggu    ug aaggaga cucu  uuccucauac ua  cau  u
                 |||||    || ||||||| ||||  |||||||||| ||  |||  u
3'               gucca    ac uuccucu gagg  aaggaguaug au  gua  u
   ----------uuuu     ccuu  c       a    ua          a  ag   uc 
Get sequence
Deep sequencing
3248 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 89658911-89659020 [-]
intergenic
Database links

Mature sequence gga-miR-1684b-3p

Accession MIMAT0025785
Sequence

69 - 

aaguaugaggaaauggagaucu

 - 90

Get sequence
Deep sequencing3246 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).