Stem-loop sequence gga-mir-6651

AccessionMI0022470 (change log)
DescriptionGallus gallus miR-6651 stem-loop
Literature search

2 open access papers mention gga-mir-6651
(5 sentences)

Stem-loop
   agccccggugagccgaggca a     uu   ua     g         ccca   u 
5'                     c ccagg  gcc  aggag gggugccag    ugg c
                       | |||||  |||  ||||| |||||||||    |||  
3'                     g gguuc  ugg  uccuc uccaugguc    auc a
   gcccagaccuccgcauggga c     -u   --     g         ---a   g 
Get sequence
Deep sequencing
80 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 48684570-48684679 [+]
intergenic
Database links

Mature sequence gga-miR-6651-5p

Accession MIMAT0025751
Sequence

22 - 

accagguugccuaaggagggg

 - 42

Get sequence
Deep sequencing26 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).