Stem-loop sequence gga-mir-365b

AccessionMI0022403 (change log)
DescriptionGallus gallus miR-365b stem-loop
Literature search

5 open access papers mention gga-mir-365b
(16 sentences)

Stem-loop
   cacagaagaa       -a   caauaa        a      uuau   a    aa 
5'           uacugca  gag      ggauuuuu ggggca    gau gugu  u
             |||||||  |||      |||||||| ||||||    ||| ||||  g
3'           auggcgu  cuu      ccugaaaa ccccgu    cua caca  g
   -uaccgagaa       cc   uuacuc        c      ----   -    aa 
Get sequence
Deep sequencing
20 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr14: 769102-769211 [-]
antisense
Clustered miRNAs
< 10kb from gga-mir-365b
gga-mir-365-1chr14: 769114-769198 [+]
gga-mir-365bchr14: 769102-769211 [-]
gga-mir-193bchr14: 764296-764378 [+]
gga-mir-6686chr14: 759895-760004 [+]
Database links

Mature sequence gga-miR-365b-5p

Accession MIMAT0025674
Sequence

27 - 

aggauuuuuaggggcauuauga

 - 48

Get sequence
Deep sequencing19 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).