Stem-loop sequence gga-mir-3064

AccessionMI0022380 (change log)
DescriptionGallus gallus miR-3064 stem-loop
Gene family MIPF0001238; mir-3064
Literature search

1 open access papers mention gga-mir-3064
(2 sentences)

Stem-loop
   --------acuauugucuaacguu       --g     ---gc     ug     -     cuuu  a 
5'                         uaucuuc   auuug     uguug  gugug caaaa    gu c
                           |||||||   |||||     |||||  ||||| |||||    || c
3'                         guagaag   uagac     acaac  cacac guuuu    cg u
   ucaguauuaacuacuguuuaaagu       gug     auuuc     gu     c     ---u  u 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr18: 6961443-6961566 [-]
sense
ENSGALT00000005586 ; DDX5-201; exon 12
Database links

Mature sequence gga-miR-3064-5p

Accession MIMAT0025631
Sequence

28 - 

uggcuguuguggugugcaaaa

 - 48

Get sequence
Deep sequencing13 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-3064-3p

Accession MIMAT0025632
Sequence

65 - 

uugccacacugcaacacuuuaca

 - 87

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).