Stem-loop sequence gga-mir-6561

AccessionMI0022379 (change log)
DescriptionGallus gallus miR-6561 stem-loop
Literature search

1 open access papers mention gga-mir-6561
(3 sentences)

Stem-loop
   -----uugu    c  ug    ---   c       -gca  a        --c uuu 
5'          ggcc uc  cugg   acu uuuccag    gg gcucccug   c   u
            |||| ||  ||||   ||| |||||||    || ||||||||   |    
3'          ccgg ag  gacc   uga aaagguc    cc cgagggac   g   u
   auaaccagu    -  ug    cga   c       aaga  -        uac uuu 
Get sequence
Deep sequencing
20 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr8: 11216322-11216426 [+]
sense
ENSGALT00000008321 ; COL11A1-201; intron 5
Database links

Mature sequence gga-miR-6561-5p

Accession MIMAT0025629
Sequence

20 - 

ucuuuccaggcaggagcucccu

 - 41

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6561-3p

Accession MIMAT0025630
Sequence

59 - 

gggagcccagaacuggaaacag

 - 80

Get sequence
Deep sequencing12 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).