Stem-loop sequence gga-mir-222b

AccessionMI0022373 (change log)
DescriptionGallus gallus miR-222b stem-loop
Gene family MIPF0000051; mir-221
Literature search

20 open access papers mention gga-mir-222b
(144 sentences)

Stem-loop
   ----g  a a     -----  c    cu             -     gau    --cc  c 
5'      ag c cggug     cc uugg  gcucaguagucag uguag   cugu    ga a
        || | |||||     || ||||  ||||||||||||| |||||   ||||    || g
3'      uc g gccac     gg aacc  ugggucauuaguc acauc   gaca    cu u
   guacg  - c     cacca  a    ac             u     ---    auca  c 
Get sequence
Deep sequencing
12774 reads, 60 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gga-miR-222b-5p

Accession MIMAT0025617
Sequence

20 - 

ugcucaguagucaguguaggaucugu

 - 45

Get sequence
Deep sequencing685 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence gga-miR-222b-3p

Accession MIMAT0025618
Sequence

63 - 

agcuacaucugauuacugggucac

 - 86

Get sequence
Deep sequencing12086 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).