Stem-loop sequence gga-mir-6549

AccessionMI0022366 (change log)
DescriptionGallus gallus miR-6549 stem-loop
Literature search

1 open access papers mention gga-mir-6549
(1 sentences)

Stem-loop
   -------cucuu   u  ug      --a          g    u   a    cca       
5'             gga gg  gccuug   gccuucuguu ugca cug gauu   gacagc 
               ||| ||  ||||||   |||||||||| |||| ||| ||||   ||||| u
3'             ccu cc  cggaac   cggaagacga augu gac cuag   cuguuu 
   gugaccacguau   u  gu      cca          -    c   a    --a       
Get sequence
Deep sequencing
26 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr8: 24565307-24565419 [+]
sense
Database links

Mature sequence gga-miR-6549-5p

Accession MIMAT0025603
Sequence

20 - 

agccuucuguugugcaucugaga

 - 42

Get sequence
Deep sequencing25 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6549-3p

Accession MIMAT0025604
Sequence

66 - 

acagcuguaagcagaaggcaccc

 - 88

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).