Stem-loop sequence gga-mir-124c

AccessionMI0022364 (change log)
DescriptionGallus gallus miR-124c stem-loop
Gene family MIPF0000021; mir-124
Literature search

12 open access papers mention gga-mir-124c
(36 sentences)

Stem-loop
   u  cg   gg   a  c  -    g ca     c   ug    a   guau 
5'  gc  ccu  agg uc gc ucuu g  uucac gcg  ccuu auu    g
    ||  |||  ||| || || |||| |  ||||| |||  |||| |||    a
3'  cg  ggg  ucc ag cg agag c  aagug cgc  ggaa uaa    c
   g  -a   --   g  a  g    g ac     u   cu    c   auua 
Get sequence
Deep sequencing
337 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 114701957-114702057 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-124c
gga-mir-1714chr2: 114704973-114705048 [+]
gga-mir-124achr2: 114701964-114702059 [+]
gga-mir-124cchr2: 114701957-114702057 [-]
Database links

Mature sequence gga-miR-124c-5p

Accession MIMAT0025599
Sequence

26 - 

cauucaccgcgugccuuaauu

 - 46

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-124c-3p

Accession MIMAT0025600
Sequence

60 - 

ucaagguccgcugugaacacgg

 - 81

Get sequence
Deep sequencing335 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).