Stem-loop sequence mmu-mir-6541

AccessionMI0022358 (change log)
Symbol MGI:Mir6541
DescriptionMus musculus miR-6541 stem-loop
Literature search

1 open access papers mention mmu-mir-6541
(1 sentences)

Stem-loop
   agga    aa    u   acacaca  aac     g            a   c   cc 
5'     uuag  aucu cau       uc   ugaga aguccuugccug gca aag  c
       ||||  |||| |||       ||   ||||| |||||||||||| ||| |||   
3'     aguc  uaga gua       ag   acucu ucaggaacggac cgu uuc  u
   --gg    gg    -   --cccaa  --a     -            a   u   cu 
Get sequence
Deep sequencing
3801 reads, 4.35 reads per million, 46 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 62865542-62865651 [+]
sense
ENSMUST00000014691 ; Wdfy2-201; intron 1
Database links

Mature sequence mmu-miR-6541

Accession MIMAT0025588
Sequence

69 - 

cacaggcaaggacuucucaag

 - 89

Get sequence
Deep sequencing3792 reads, 42 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20605486 "Regulation of microRNA expression and abundance during lymphopoiesis" Kuchen S, Resch W, Yamane A, Kuo N, Li Z, Chakraborty T, Wei L, Laurence A, Yasuda T, Peng S, Hu-Li J, Lu K, Dubois W, Kitamura Y, Charles N, Sun HW, Muljo S, Schwartzberg PL, Paul WE, O'Shea J, Rajewsky K, Casellas R Immunity. 32:828-839(2010).