Stem-loop sequence mmu-mir-3473e

AccessionMI0022357 (change log)
Symbol MGI:Mir3473e
DescriptionMus musculus miR-3473e stem-loop
Literature search

4 open access papers mention mmu-mir-3473e
(71 sentences)

Stem-loop
   --------cucugccuucaa    c    ac    -  gga    u   -  gua  gaa 
5'                     gaga ugac  uggg cu   gaga ggc uc   ag   g
                       |||| ||||  |||| ||   |||| ||| ||   ||    
3'                     cuuu acug  accc gg   cucu ucg ag   uc   a
   acagacggaacacccaugac    a    ga    a  aga    u   u  --g  aca 
Get sequence
Deep sequencing
49116 reads, 227 reads per million, 98 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 31667231-31667340 [-]
sense
OTTMUST00000070182 ; Rbks-001; intron 2
OTTMUST00000070184 ; Rbks-003; intron 2
ENSMUST00000031018 ; Rbks-001; intron 2
ENSMUST00000128047 ; Rbks-003; intron 2
antisense
OTTMUST00000070177 ; Mrpl33-007; intron 2
OTTMUST00000070185 ; Mrpl33-010; intron 3
ENSMUST00000142394 ; Mrpl33-007; intron 2
ENSMUST00000138996 ; Mrpl33-010; intron 3
Database links

Mature sequence mmu-miR-3473e

Accession MIMAT0025587
Sequence

25 - 

gggcuggagagauggcucgua

 - 45

Get sequence
Deep sequencing49085 reads, 97 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20605486 "Regulation of microRNA expression and abundance during lymphopoiesis" Kuchen S, Resch W, Yamane A, Kuo N, Li Z, Chakraborty T, Wei L, Laurence A, Yasuda T, Peng S, Hu-Li J, Lu K, Dubois W, Kitamura Y, Charles N, Sun HW, Muljo S, Schwartzberg PL, Paul WE, O'Shea J, Rajewsky K, Casellas R Immunity. 32:828-839(2010).