Stem-loop sequence mmu-mir-6538

AccessionMI0022354 (change log)
Symbol MGI:Mir6538
DescriptionMus musculus miR-6538 stem-loop
Literature search

2 open access papers mention mmu-mir-6538
(3 sentences)

Stem-loop
   --------------------ccgugcugccgggcgggg    c     -c         gcgau g 
5'                                       accc gcggg  uccggggcg     g g
                                         |||| |||||  |||||||||     |  
3'                                       uggg cgccu  gggccucgu     c g
   cuagggguucacguucgccgguccuccugcgccggcag    u     ua         ---au a 
Get sequence
Deep sequencing
3974 reads, 1.52 reads per million, 66 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 26414901-26415010 [-]
sense
ENSMUST00000020971 ; Rnf144a-201; intron 1
ENSMUST00000062149 ; Rnf144a-202; intron 1
Database links

Mature sequence mmu-miR-6538

Accession MIMAT0025583
Sequence

23 - 

cgcgggcuccggggcggcg

 - 41

Get sequence
Deep sequencing3965 reads, 66 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20605486 "Regulation of microRNA expression and abundance during lymphopoiesis" Kuchen S, Resch W, Yamane A, Kuo N, Li Z, Chakraborty T, Wei L, Laurence A, Yasuda T, Peng S, Hu-Li J, Lu K, Dubois W, Kitamura Y, Charles N, Sun HW, Muljo S, Schwartzberg PL, Paul WE, O'Shea J, Rajewsky K, Casellas R Immunity. 32:828-839(2010).