Stem-loop sequence bta-mir-2284z-2

AccessionMI0022351 (change log)
DescriptionBos taurus miR-2284z-2 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

13 open access papers mention bta-mir-2284z-2
(32 sentences)

Stem-loop
   -   a      a        ug           cu ua 
5'  uug guuggc aaaaaguu  uuuggguuuuu  g  a
    ||| |||||| ||||||||  |||||||||||  |   
3'  gac caaccg uuuuucaa  agacccaaaaa  c  u
   u   c      g        gu           uu ua 
Get sequence
Deep sequencing
11092 reads, 49.3 reads per million, 73 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr11: 21501152-21501228 [-]
sense
ENSBTAT00000015471 ; SOS1-201; intron 9
Database links

Mature sequence bta-miR-2284z

Accession MIMAT0025559
Sequence

11 - 

aaaaaaguuuguuuggguuuuu

 - 32

Get sequence
Deep sequencing73137 reads, 73 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).