Stem-loop sequence bta-mir-2285v

AccessionMI0022350 (change log)
DescriptionBos taurus miR-2285v stem-loop
Gene family MIPF0000747; mir-2284
Literature search

12 open access papers mention bta-mir-2285v
(16 sentences)

Stem-loop
   a                    a   g        auua c 
5'  uuggguuggccagaaaguuc uuu gguuuuuc    c a
    |||||||||||||||||||| ||| ||||||||    |  
3'  aacccaaccgguuuuucaag aag ccaagagg    g u
   -                    c   g        guac g 
Get sequence
Deep sequencing
802 reads, 0 reads per million, 65 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr10: 9099299-9099379 [-]
sense
ENSBTAT00000006605 ; AP3B1-201; intron 23
Database links

Mature sequence bta-miR-2285v

Accession MIMAT0025579
Sequence

51 - 

agaaccggaacgaacuuuuug

 - 71

Get sequence
Deep sequencing677 reads, 56 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).