Stem-loop sequence bta-mir-2285b-2

AccessionMI0022349 (change log)
DescriptionBos taurus miR-2285b-2 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285b-2
(15 sentences)

Stem-loop
   c      -a               ug             g 
5'  uggggu  gccaaaaaguucauu  gguuuuucuguaa a
    ||||||  |||||||||||||||  |||||||||||||  
3'  aucuca  cgguuuuucaaguga  cuaaaaagacauu u
   u      ac               gu             g 
Get sequence
Deep sequencing
7138 reads, 27.1 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 52757309-52757389 [-]
intergenic
Database links

Mature sequence bta-miR-2285b

Accession MIMAT0011833
Sequence

50 - 

aaaaucugagugaacuuuuugg

 - 71

Get sequence
Deep sequencing1368 reads, 66 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).