Stem-loop sequence bta-mir-2285s

AccessionMI0022347 (change log)
DescriptionBos taurus miR-2285s stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285s
(15 sentences)

Stem-loop
   u   ug          a                       g 
5'  auu  guuggccaaa aguucauuuggguuuuucuguaa a
    |||  |||||||||| |||||||||||||||||||||||  
3'  uaa  cagccgguuu ucaagugaacccagaaagguauu u
   -   gu          c                       g 
Get sequence
Deep sequencing
6498 reads, 23.2 reads per million, 69 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bta-miR-2285s

Accession MIMAT0025576
Sequence

52 - 

aagacccaagugaacucuuugg

 - 73

Get sequence
Deep sequencing30 reads, 24 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).