Stem-loop sequence bta-mir-2285q

AccessionMI0022345 (change log)
DescriptionBos taurus miR-2285q stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285q
(15 sentences)

Stem-loop
   a     u        a                -    g   g 
5'  aaugu guuggcca aaaguucauucagguu uucu uaa a
    ||||| |||||||| |||||||||||||||| |||| |||  
3'  uuaca caaccggu uuucaaguaaguccag aagg auu u
   -     -        c                g    g   g 
Get sequence
Deep sequencing
1737 reads, 18.1 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr20: 13481349-13481431 [-]
sense
ENSBTAT00000009630 ; SREK1-201; intron 19
Clustered miRNAs
< 10kb from bta-mir-2285q
bta-mir-2285qchr20: 13481349-13481431 [-]
bta-mir-2285zchr20: 13481341-13481436 [+]
Database links

Mature sequence bta-miR-2285q

Accession MIMAT0025574
Sequence

51 - 

aaggaccugaaugaacuuucugg

 - 73

Get sequence
Deep sequencing1572 reads, 71 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).