Stem-loop sequence bta-mir-2284aa-4

AccessionMI0022343 (change log)
DescriptionBos taurus miR-2284aa-4 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

13 open access papers mention bta-mir-2284aa-4
(32 sentences)

Stem-loop
   -          aa         -uuu       c  auaac 
5'  uuggguuggc  aaaaguuug    ggguuuu uc     a
    ||||||||||  |||||||||    ||||||| ||     u
3'  gacucaaccg  uuuuuaaau    uccaaaa ag     c
   u          -g         uaau       -  acauu 
Get sequence
Deep sequencing
10677 reads, 45.2 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr9: 81548061-81548141 [+]
intergenic
Database links

Mature sequence bta-miR-2284aa

Accession MIMAT0025560
Sequence

11 - 

aaaaaaguuuguuuggguuuu

 - 31

Get sequence
Deep sequencing42697 reads, 73 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).