Stem-loop sequence bta-mir-6536-1

AccessionMI0022342 (change log)
DescriptionBos taurus miR-6536-1 stem-loop
Gene family MIPF0001479; mir-6536
Literature search

2 open access papers mention bta-mir-6536-1
(2 sentences)

Stem-loop
   -                                 -cau    
5'  auugaccaacuuuaaguauacgaugaacugcag    gcc 
    |||||||||||||||||||||||||||||||||    || a
3'  ugacugguugaaauucauaugcuacuugacguc    cgg 
   u                                 ccuu    
Get sequence
Deep sequencing
84 reads, 0 reads per million, 37 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr9: 39576511-39576591 [+]
sense
ENSBTAT00000060948 ; REV3L-201; intron 1
Clustered miRNAs
< 10kb from bta-mir-6536-1
bta-mir-6536-1chr9: 39576511-39576591 [+]
bta-mir-6536-2chr9: 39576511-39576590 [-]
Database links

Mature sequence bta-miR-6536

Accession MIMAT0025572
Sequence

11 - 

uuuaaguauacgaugaacugc

 - 31

Get sequence
Deep sequencing85 reads, 17 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).