Stem-loop sequence bta-mir-6535

AccessionMI0022340 (change log)
DescriptionBos taurus miR-6535 stem-loop
Stem-loop
   -   cug    ---  g      c   u     a    g 
5'  gcc   gggu   ua ggggag ggu ggagg cugg g
    |||   ||||   || |||||| ||| ||||| ||||  
3'  ugg   uccg   au ccucuc cca ccuuc gacu g
   g   ---    agg  g      u   u     c    c 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 19049950-19050022 [-]
sense
ENSBTAT00000063911 ; TRIP10-201; exon 2
Database links

Mature sequence bta-miR-6535

Accession MIMAT0025571
Sequence

11 - 

uagggggagcgguuggaggacu

 - 32

Get sequence
Deep sequencing17 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).