Stem-loop sequence bta-mir-2285k-5

AccessionMI0022337 (change log)
DescriptionBos taurus miR-2285k-5 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285k-5
(16 sentences)

Stem-loop
   a                        a        uu   c 
5'  uuggguuggccagaaaguucauuc gguuuuuc  uaa a
    |||||||||||||||||||||||| ||||||||  |||  
3'  aacccaacugguuuuucaaguaag ccaaaaag  guu g
   -                        g        uc   c 
Get sequence
Deep sequencing
10135 reads, 224 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 53797582-53797662 [-]
sense
ENSBTAT00000027912 ; LRRC8D-201; intron 1
Database links

Mature sequence bta-miR-2285k

Accession MIMAT0024586
Sequence

51 - 

aaaaccggaaugaacuuuuug

 - 71

Get sequence
Deep sequencing47879 reads, 78 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).