Stem-loop sequence bta-mir-6534

AccessionMI0022335 (change log)
DescriptionBos taurus miR-6534 stem-loop
Stem-loop
   ggccuc    c  g   u   -  uca    ca    ag 
5'       ccag uc guc cug cu   gcuc  ggaa  a
         |||| || ||| ||| ||   ||||  ||||  a
3'       gguu ag cag gac ga   cgag  ucuu  u
   guacau    u  g   -   u  ---    aa    au 
Get sequence
Deep sequencing
31 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 14441067-14441142 [+]
sense
ENSBTAT00000033914 ; GPATCH4-201; intron 2
Database links

Mature sequence bta-miR-6534

Accession MIMAT0025570
Sequence

45 - 

ucuaagagcagucaggacggau

 - 66

Get sequence
Deep sequencing30 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).