Stem-loop sequence bta-mir-6533

AccessionMI0022334 (change log)
DescriptionBos taurus miR-6533 stem-loop
Stem-loop
   ucac    aa    -        --a        c   c 
5'     gaac  guuc cugaugcu   ccgcauca gaa a
       ||||  |||| ||||||||   |||||||| |||  
3'     cuug  caag gauuacga   ggcguagu cuu a
   augu    aa    a        gac        c   g 
Get sequence
Deep sequencing
30 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr28: 24980703-24980779 [-]
intergenic
Database links

Mature sequence bta-miR-6533

Accession MIMAT0025569
Sequence

47 - 

ugcggcagagcauuagagaac

 - 67

Get sequence
Deep sequencing17 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).