Stem-loop sequence bta-mir-6532

AccessionMI0022333 (change log)
DescriptionBos taurus miR-6532 stem-loop
Stem-loop
   ca        c       --        u  u   -   g 
5'   uccuucuc agccguc  uccugucc gu cug ugu c
     |||||||| |||||||  |||||||| || ||| ||| u
3'   agggagag uuggcag  aggacagg cg gac aca g
   aa        u       aa        -  u   g   a 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr27: 42494396-42494474 [-]
sense
ENSBTAT00000063214 ; UBE2E2-201; intron 2
Database links

Mature sequence bta-miR-6532

Accession MIMAT0025568
Sequence

47 - 

agugcggacaggaaagacgguuu

 - 69

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).