Stem-loop sequence bta-mir-6531

AccessionMI0022331 (change log)
DescriptionBos taurus miR-6531 stem-loop
Stem-loop
   uac    u       u    --   cuuu     ac    uug 
5'    cuac ucuagac uggu  gua    gagag  agug   u
      |||| ||||||| ||||  |||    |||||  ||||    
3'    ggug aggucug aucg  cau    uuuuc  ucgu   u
   aac    c       u    uu   -auu     -c    uuu 
Get sequence
Deep sequencing
103 reads, 0 reads per million, 44 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr23: 31672917-31673000 [-]
sense
ENSBTAT00000056983 ; HIST1H2AC-201; 5'UTR (exon 1)
Database links

Mature sequence bta-miR-6531

Accession MIMAT0025567
Sequence

11 - 

uagacuugguguacuuugagaga

 - 33

Get sequence
Deep sequencing79 reads, 40 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).