Stem-loop sequence bta-mir-6530

AccessionMI0022330 (change log)
DescriptionBos taurus miR-6530 stem-loop
Stem-loop
   agaug   ---       ag aag     -    ca   c 
5'      gac   accgcgg  g   guaag acgg  gcg c
        |||   |||||||  |   ||||| ||||  |||  
3'      cug   uggcgcc  c   cguuc uguc  cgc c
   ccggg   ggc       cu -gg     g    -c   g 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr20: 63230045-63230120 [-]
intergenic
Database links

Mature sequence bta-miR-6530

Accession MIMAT0025566
Sequence

11 - 

cgcggaggaagguaagacgg

 - 30

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).