Stem-loop sequence bta-mir-6529a

AccessionMI0022328 (change log)
Previous IDsbta-mir-6529
DescriptionBos taurus miR-6529 stem-loop
Gene family MIPF0001771; mir-6529
Literature search

2 open access papers mention bta-mir-6529a
(4 sentences)

Stem-loop
   c   u       -   auc          a  gcg   au 
5'  ugu cucuuga gag   agaggcgcag gu   uca  g
    ||| ||||||| |||   |||||||||| ||   |||  u
3'  acg gagaauu cuc   uuuccguguc cg   agu  c
   c   c       u   cau          -  --a   aa 
Get sequence
Deep sequencing
12262 reads, 97.1 reads per million, 70 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 65675397-65675475 [-]
sense
ENSBTAT00000065045 ; GSK3B-201; intron 1
Clustered miRNAs
< 10kb from bta-mir-6529a
bta-mir-6529achr1: 65675397-65675475 [-]
bta-mir-6529bchr1: 65675391-65675480 [+]
Database links

Mature sequence bta-miR-6529a

Accession MIMAT0025565
Previous IDsbta-miR-6529
Sequence

11 - 

gagagaucagaggcgcagagu

 - 31

Get sequence
Deep sequencing12101 reads, 70 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).