Stem-loop sequence bta-mir-6527

AccessionMI0022323 (change log)
DescriptionBos taurus miR-6527 stem-loop
Stem-loop
   u   ccauauug  g   aac    aa g       aa gaug   g uc 
5'  ugu        cc guc   cuuc  u acgugga  a    gcg c  a
    |||        || |||   ||||  | |||||||  |    ||| |   
3'  aca        gg uag   gaag  g ugcacuu  u    cgc g  c
   g   -aaaucca  g   --a    ca g       gg ---a   - ua 
Get sequence
Deep sequencing
32 reads, 0 reads per million, 19 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 79865937-79866031 [-]
sense
ENSBTAT00000000445 ; bta-mir-6527-201; exon 3
Database links

Mature sequence bta-miR-6527

Accession MIMAT0025561
Sequence

65 - 

cacguggacgaagagauggga

 - 85

Get sequence
Deep sequencing30 reads, 18 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).