Stem-loop sequence bta-mir-2285n-7

AccessionMI0022319 (change log)
DescriptionBos taurus miR-2285n-7 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285n-7
(15 sentences)

Stem-loop
   --    c  a      a   ug    a      - c  aac 
5'   uggg ug ccaaaa guu  uucg guuuuu c gu   a
     |||| || |||||| |||  |||| |||||| | ||    
3'   accc ac gguuuu caa  aagc caaaaa g ca   u
   cg    a  c      -   gu    c      a u  ccc 
Get sequence
Deep sequencing
1475 reads, 26.4 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 131408848-131408927 [+]
intergenic
Database links

Mature sequence bta-miR-2285n

Accession MIMAT0025531
Sequence

49 - 

aaaaacccgaaugaacuuuugg

 - 70

Get sequence
Deep sequencing24101 reads, 77 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).